sgRNA read counts of a genome-wide CRISPR-Cas9 knockout screen in HAP1 cells with the TKOv3 library (Hart et al. 2017): the T0 sample and three replicates after 3 and 18 days of growth. The sgRNAs of the genes needed for growth (essential genes) are depleted over time. It is the example dataset of the CRISPR tutorial.
Usage
data(hap1_count_table)Format
A data frame with 13600 rows (sgRNAs) and 8 columns:
- Barcode
The sgRNA identifier (gene and guide sequence).
- T0
The counts at the start of the screen.
- T3_A, T3_B, T3_C
The counts of the three replicates after 3 days.
- T18_A, T18_B, T18_C
The counts after 18 days.
Source
Hart T, Tong AHY, Chan K, et al. (2017). Evaluation and design of genome-wide CRISPR/SpCas9 knockout screens. G3 7:2719-2727. doi:10.1534/g3.117.041277
Details
To keep the package small, the dataset is a subset of the library (70,877
sgRNAs, 4 for each of about 18,000 genes): all the sgRNAs of the core
essential and non-essential reference genes
(hart_reference_genes), all the sgRNAs on chromosome 15, the
sgRNAs of 1500 other randomly chosen genes and the control sgRNAs (EGFP,
LacZ, luciferase). Because it is a subset, it must not be used with
correct_crispr_bias, which needs the complete library. The
script that builds it is in the scripts folder of the installed package
(system.file("scripts", package = "ScreenR")).
The data come from the example data of BAGEL2
(https://github.com/hart-lab/bagel), distributed under the MIT
license, Copyright (c) 2020 Hart Lab (see
system.file("LICENSES_data.txt", package = "ScreenR")).
Examples
data(hap1_count_table)
head(hap1_count_table)
#> Barcode T0 T3_A T3_B T3_C T18_A T18_B T18_C
#> 1 EGFP_TGGTTGTCGGGCAGCAGCAC 537 222 150 216 243 115 304
#> 2 EGFP_GGTTGTCGGGCAGCAGCACG 210 197 92 125 195 177 115
#> 3 EGFP_TTCAAGTCCGCCATGCCCGA 517 423 255 282 329 309 433
#> 4 EGFP_CGGCGGTCACGAACTCCAGC 278 167 54 120 165 184 65
#> 5 EGFP_GGTGCCCATCCTGGTCGAGC 83 99 41 19 107 103 44
#> 6 EGFP_GAAGTTCGAGGGCGACACCC 268 145 153 204 133 295 228